pgemt-easy vectors (Promega)
90
Structured Review
Promega
pgemt-easy vectors
Pgemt Easy Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgemt-easy+vectors/pgem+t+easy/pm40198437-81-16-17
Average 90 stars, based on 1 article reviews
Pgemt Easy Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgemt-easy+vectors/pgem+t+easy/pm40198437-81-16-17
Average 90 stars, based on 1 article reviews
pgemt-easy vectors - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Amplification:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Clone Assay:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Polymerase Chain Reaction:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Incubation:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Gel Extraction:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Cloning:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Purification:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Sequencing:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Agarose Gel Electrophoresis:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Inverse PCR:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Isolation:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. In Situ Hybridization:Article Title: DNA CpG Methylation (5-Methylcytosine) and Its Derivative (5-Hydroxymethylcytosine) Alter Histone Posttranslational Modifications at the Pomc Promoter, Affecting the Impact of Perinatal Diet on Leanness and Obesity of the Offspring. Article Snippet: The PCR products were cloned into PGEMT-easy vectors (Promega, Madison, WI), Page 7 of 31 For Peer Review Only Diabetes 8 inserted into Article Title: Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. Article Snippet: PCR amplifications were performed using KAPA SYBR FAST Master Mix (Kapabiosystems Inc., Boston, MA) under the following conditions: an initial incubation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 53 °C for 20 s, and elongation at 64 °C for 45 s. The PCR products were separated on an agarose gel (1.5%), extracted with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into Article Title: Do carotenoids protect phytodetritus-associated bacteria from oxidative stress? Article Snippet: To plot the standard curves, fragments of the targeted genes were amplified and cloned into Article Title: Cytokinin biosynthesis ISOPENTENYLTRANSFERASE genes are differentially expressed during phyllomorph development in the acaulescent Streptocarpus rexii (Gesneriaceae) Article Snippet: Method Gene Forward/reverse Primer sequence (5′-3′) 3′RACE SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT2 Forward GAGTGCCGCATCATCTGCTTGG SrIPT3 Forward GAGTGCCGCATCATCTGCTTGG SrIPT5 Forward GTGGAATCCGGCGTGCTATC SrIPT9 Forward CAGAGAACAAGGGAGCTGGA Adaptor Reverse GACTCGAGTCGACATCG Inverse PCR SrIPT1 Forward TGGACTCCGCCTTCAGTAAG SrIPT1 Reverse TCTGGGTTGTATTTCTTCGCCA TAIL PCR Adaptor Forward AGWGNAGWANCAWAGG SrIPT3 Reverse CCTCCACGGAAACTGCGCTGCCACCGTAA SrIPT3 Reverse ACGTCGGTGGCGTCGAGGCGGTGTAGGT SrIPT3 Reverse AGCGGCGGAGAAGTCGGATTCGGGGTCA Intron isolation SrIPT2 Forward CCGGATGCAGACGAGAATTT SrIPT2 Reverse CGCTGAAACTGGGTCAAGAT SrIPT2 Forward CCACTTCCCCATCGAAATTA SrIPT2 Reverse AGCTTCGCATCTTCCTCAAA SrIPT9 Forward CATGCTCAAACGGAGAAAGG SrIPT9 Reverse GGGTAATGGAAAGGCTGATG SrIPT9 Forward AGCAGGTGATCCAGGTGTTC SrIPT9 Reverse TCCAGCTCCCTTGTTCTCTG SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse GCAAGTGCCAGAACTTCTTTACC Realtime PCR SrIPT1 Forward CAGTCGAACCCTGTCAGCAAA SrIPT1 Reverse GGACCCGAGATTCGCCATTAT SrIPT3 Forward CCGCCAGGTGGAGAAGATTAT SrIPT3 Reverse TCGACATCCTTGCCGCTTT SrIPT5 Forward GCTTTCCTCAAACTTGGCGAC SrIPT5 Reverse GCGAGAACATTGGTGTGGTGT SrIPT9 Forward GAGGCACAGTGGCTTCTTGA SrIPT9 Reverse CCCTTGTTCTCTGCACGCTA 18S rRNA Forward TGACGGAGAATTAGGGTTCGA 18S rRNA Reverse GGATGTGGTAGCCGTTTCTCA ISH probes SrIPT5 Forward CGGAAAGACAAGGTGGTTGT SrIPT5 Reverse CATAGGAATTCGACCCTCCA SrIPT9 Forward CAGAGAACAAGGGAGCTGGA SrIPT9 Reverse ATGCTGCCACAGTCCTCTCT Table A2 Partial sequences of SrIPT genes were inserted into pGEMt-easy Article Title: Lack of Cyclin B1 in zebrafish causes lengthening of G2 and M phases. Article Snippet: Purified PCR products were then subcloned into pGEMT-Easy Article Title: Paternal high-fat diet affects weight and DNA methylation of their offspring Article Snippet: PCR amplification of the fragment was performed using Biotaq DNA Polymerase (Bioline USA Inc., Taunton, MA, USA) under the following conditions: initial incubation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 45 s. The PCR products were separated on agarose gels (1.5%) followed by gel extraction with a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloning into Article Title: Exposure of pregnant mice to triclosan causes hyperphagic obesity of offspring via the hypermethylation of proopiomelanocortin promoter. Article Snippet: Triclosan (TCS), as a broad spectrum antibacterial agent, is commonly utilized in personal care and household products.. Maternal urinary TCS level has been associated with changes in birth weight of infants.. We in the present study investigated whether exposure of mice to 8 mg/kg TCS from gestational day (GD) 6 to GD14 alters prenatal and postnatal growth and development, and metabolic phenotypes in male and female offspring (TCS-offspring). Article Title: PARP Inhibitor Affects Long-term Heat-stress Response via Changes in DNA Methylation. Article Snippet: Accepted Manuscript Research Article PARP inhibitor affects long-term heat-stress response via changes in DNA methylation Tomer Cramer, Tali Rosenberg, Tatiana Kisliouk, Noam Meiri PII: S0306-4522(18)30827-3 DOI: https://doi.org/10.1016/j.neuroscience.2018.12.018 Reference: NSC 18793 To appear in: Neuroscience Received Date: 6 October 2018 Revised Date: 12 December 2018 Accepted Date: 13 December 2018 Please cite this article as: T. Cramer, T. Rosenberg, T. Kisliouk, N. Meiri, PARP inhibitor affects long-term heatstress response via changes in DNA methylation, Neuroscience (2018), doi: https://doi.org/10.1016/j.neuroscience.. 2018.12.018 This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. |